View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17962_low_66 (Length: 213)
Name: NF17962_low_66
Description: NF17962
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17962_low_66 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 100; Significance: 1e-49; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 110 - 213
Target Start/End: Original strand, 2786164 - 2786267
Alignment:
| Q |
110 |
acatcatcaactttaacatgaatttgatttgaaggcaagtttgttgttccggaaggactcaaggcagtgcgggcttccctgaaaccttctgatatcaaaa |
209 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2786164 |
acatcgtcaactttaacatgaatttgatttgaaggcaagtttgttgttccggaaggactcaaggcagtgcgggcttccctgaaaccttctgatatcaaaa |
2786263 |
T |
|
| Q |
210 |
caag |
213 |
Q |
| |
|
|||| |
|
|
| T |
2786264 |
caag |
2786267 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 165 - 209
Target Start/End: Complemental strand, 22518281 - 22518237
Alignment:
| Q |
165 |
gactcaaggcagtgcgggcttccctgaaaccttctgatatcaaaa |
209 |
Q |
| |
|
||||||||||| ||||||||||||| |||||||||||||| |||| |
|
|
| T |
22518281 |
gactcaaggcactgcgggcttccctaaaaccttctgatattaaaa |
22518237 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University