View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17963_low_10 (Length: 307)
Name: NF17963_low_10
Description: NF17963
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17963_low_10 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 1 - 289
Target Start/End: Complemental strand, 53791822 - 53791530
Alignment:
| Q |
1 |
gatgattggtttggtttcacagttcagcttactactgaaaaactaa-gcacccgtgagacaaacatgtgcaacgtgtacaacattggagttaaataaata |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53791822 |
gatgattggtttggtttcacagttcagcttact---gaaaaactaaagcacccgtgagacaaacatgtgcaacgtgtacaacattggagttaaataaata |
53791726 |
T |
 |
| Q |
100 |
aagtcaaataactcatttgttcgtttcgtatgcatacaaaactaacattatatctactctatactatatacaaaactaagtagcttttcttccttg---- |
195 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53791725 |
aagtcaaataactcatttgttcgttttgtatgcatacaaaactaacattatatctactctatactatatacaaaactaagtagcttttcttccttgtatt |
53791626 |
T |
 |
| Q |
196 |
-tatttagcctgcctttgcgttattgaact-acttttttggaagacacaaacattatttcttggaaaaagactttccatgtcttgttcatggtatt |
289 |
Q |
| |
|
||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53791625 |
gtatttagcctggctttgcgttattgaactaacttttttggaagacacaaacattatttcttggaaaaagactttccatgtcttgttcatggtatt |
53791530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University