View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17963_low_12 (Length: 300)
Name: NF17963_low_12
Description: NF17963
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17963_low_12 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 181; Significance: 8e-98; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 181; E-Value: 8e-98
Query Start/End: Original strand, 48 - 243
Target Start/End: Complemental strand, 33050264 - 33050068
Alignment:
| Q |
48 |
ccaagaagttagtaagttagtgattgattggtatcaatatcaatcacc-aattcattggagtccttaacatagctgccaatcatacactaactaactaac |
146 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33050264 |
ccaagaagttagtaagttagtgattgattggtatcaatatcaatcacccaattcattggagtccttaacatagctgccaatcatacactaactaactaac |
33050165 |
T |
 |
| Q |
147 |
taagtcattaattgaggtttggctaagtgaattgggagttgaataagcggattaacgtttttctacgatttgagaaagtaagggtttttcgacatgt |
243 |
Q |
| |
|
||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33050164 |
taagttattaattgaggtttggctaagtgaatcgggagttgaataagcggattaacgtttttctacgatttgagaaagtaagggtttttcgacatgt |
33050068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University