View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17963_low_22 (Length: 253)
Name: NF17963_low_22
Description: NF17963
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17963_low_22 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 17 - 243
Target Start/End: Complemental strand, 2051540 - 2051314
Alignment:
| Q |
17 |
agttggttacatgcgaagaatcaaattcagcacttgttgtagttccaacatcaagggctagtagtagtagttattatggaacaagatcatcatggaagag |
116 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2051540 |
agttggttacatgtgaagaatcaaattcagcacttgttgtagttccaacatcaagggctagtagtagtagttattatggaacaagatcatcatggaagaa |
2051441 |
T |
 |
| Q |
117 |
ttctgtggtgaagaggaataagaagttgaaggtggataaacaagagagactgttgcttacaaatggaagccctagtccttcaatgatgcctgctcttgct |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2051440 |
ttctgtggtgaagaggaataagaagttgaaggtggataaacaagagagactgttgcttacaaatggaagccctagtccttcaatgatgcctgctcttgct |
2051341 |
T |
 |
| Q |
217 |
cttgatagtttttgtagtactcctatg |
243 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
2051340 |
cttgatagtttttgtagtactcctatg |
2051314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University