View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17963_low_7 (Length: 329)
Name: NF17963_low_7
Description: NF17963
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17963_low_7 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 17 - 317
Target Start/End: Original strand, 10684354 - 10684668
Alignment:
| Q |
17 |
gtattctcaagagtgaaccttgaaatagcagaattcccttcttgttctgtcattctttgcttagcaacttcaatctttgccccctcctgttgttattcaa |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10684354 |
gtattctcaagagtgaaccttgaaatagcagaattcccttcttgttctgtcattctttgcttagcaacttcaatctttgccccctcctgttgttattcaa |
10684453 |
T |
|
| Q |
117 |
cacacaatgcataatcgtgttagttaagagaaatggtat-------------tttgacatcaaacttcgaaatcaatttaaacggttaacgtagttccat |
203 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
10684454 |
cacacaatgcataatcgtgttcgttaagagaaatggtattttgacatccaaatttgacatcaaacttcgaaatcaatttaaatggttaacgtagttccat |
10684553 |
T |
|
| Q |
204 |
atatgttaattgtgttcaatgaatagttaatgaatataacaaggttcataatttatttatcatcca-cgaacacaattgtccacgattttaaacatcagt |
302 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||| |
|
|
| T |
10684554 |
atatgttaattgtgttcaatgaatagttaatgaatataacaaggttcataatttatttatcatccatggaacacaattaaccacgattttaaacatcagt |
10684653 |
T |
|
| Q |
303 |
aaccacttttcatat |
317 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
10684654 |
aaccacttttcatat |
10684668 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University