View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17964_high_26 (Length: 307)
Name: NF17964_high_26
Description: NF17964
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17964_high_26 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 78 - 306
Target Start/End: Original strand, 37974658 - 37974886
Alignment:
| Q |
78 |
aaggatttgaagaggatgaaggcgaatttcgaggagttgtgtgacgaggataagattttggtgttttttaagaagctgttgaatgagtggaaacaggagt |
177 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
37974658 |
aaggatttgaaaaggatgaaggcgaatttcgaggagttgtgtgatgaggataagattttggtgtttttcaagaagctgttgaatgagtggaaacaggagt |
37974757 |
T |
 |
| Q |
178 |
tgcgtgagatggctgagacggagaagcggactgctaaagggaagtctatggttgctacattcaagcagtgtgcgcgatacttgaacccgctgtttaagtt |
277 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37974758 |
tgcgtgagatggcggagacggagaagcggactgctaaagggaagtctatggttgctacattcaagcagtgtgcgcgatacttgaacccgctgtttaagtt |
37974857 |
T |
 |
| Q |
278 |
ttgtaggaagaaggtgagttttattctgt |
306 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
37974858 |
ttgtaggaagaaggtgagttttattctgt |
37974886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University