View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17964_high_43 (Length: 231)
Name: NF17964_high_43
Description: NF17964
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17964_high_43 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 1 - 212
Target Start/End: Original strand, 46332706 - 46332917
Alignment:
| Q |
1 |
tagaaaaaataatcattggagacaattaaacttcccaacccctcccttccactttcccttcctttcaatgatgatgcagttaattttgatccacatgnnn |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46332706 |
tagaaaaaataatcattggagacaattaaacttcccaacccctcccttccactttcccttcctttcaatgatgatgcagttaattttgatccacatgttt |
46332805 |
T |
 |
| Q |
101 |
nnnnnnnnnnnnnnnccacagtcaaccaataacaaataaactttttgcacaacttgtaagttttatatgattnnnnnnntataacgatttgtgattgatt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
46332806 |
tttttttttttttttccacagtcaaccaataacaaataaactttttgcacaacttgtaagttttatatgattaaaaaaatataacgatttgtgattgatt |
46332905 |
T |
 |
| Q |
201 |
gagagtgtatca |
212 |
Q |
| |
|
|||||||||||| |
|
|
| T |
46332906 |
gagagtgtatca |
46332917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University