View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17964_high_47 (Length: 216)
Name: NF17964_high_47
Description: NF17964
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17964_high_47 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 20 - 180
Target Start/End: Complemental strand, 4531536 - 4531375
Alignment:
| Q |
20 |
aataataaattcaactttatcacaatatcaagttacaaaatcagaatgaggacttacccttttgaagattgaaaactttttcacaataaaagctacttat |
119 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
4531536 |
aataataaattcaattttatcacaatatcaagttacaaaatcagaatgaggacttacccttttgaagattgaaaactttatcacaataaaagctacttat |
4531437 |
T |
 |
| Q |
120 |
ttaatgactctagccaccaattggcacaga-aaaagctgtgaaagagaagaataaaagttgg |
180 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
4531436 |
ttaatgactctagccagcaattggcacagaaaaaagctgtgaaagagaagaataaaagttgg |
4531375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University