View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17964_low_18 (Length: 372)
Name: NF17964_low_18
Description: NF17964
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17964_low_18 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 131; Significance: 7e-68; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 131; E-Value: 7e-68
Query Start/End: Original strand, 147 - 289
Target Start/End: Original strand, 23957376 - 23957518
Alignment:
| Q |
147 |
tgtttgttgggcgtgagttgaaaacatgagaggtgatgtatatatagaggcacttgcacatgtcaagctgggttttgtctcgtgaatagaggataagaga |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||| |
|
|
| T |
23957376 |
tgtttgttgggcgtgagttgaaaacatgagaggtgatgtatatatagaggcacttgcacatgtcaagctgggttttgttttgtgaatagaggataagaga |
23957475 |
T |
 |
| Q |
247 |
ttaaatatttgtaaatattaagggtcaaattgggaatgtgtag |
289 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23957476 |
gtaaatatttgtaaatattaagggtcaaattgggaatgtgtag |
23957518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 7 - 78
Target Start/End: Original strand, 23957210 - 23957281
Alignment:
| Q |
7 |
cctcaggcatggtgtgtgatgttttgtgagatgagaataaggagaaaatgtgaagaagacttttggtgtgta |
78 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23957210 |
cctcaggcatggtgtgtgttgttttgtgagatgagaataaggagaaaatgtgaagaagacttttggtgtgta |
23957281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University