View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17964_low_24 (Length: 313)
Name: NF17964_low_24
Description: NF17964
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17964_low_24 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 155; Significance: 3e-82; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 155; E-Value: 3e-82
Query Start/End: Original strand, 12 - 211
Target Start/End: Complemental strand, 36823041 - 36822837
Alignment:
| Q |
12 |
atgaaactatttaaacccagacttttttgcttagattaaataaagagcaagtgaatccaacaaacttaaaatctggaaggaacaagtgattccaaccctt |
111 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36823041 |
atgaaactatttaaacccagactttttt-cttagattaaataaagagcaagtgaatccaacaaacttaaaatctggaaggaacaagtgattccaaccctt |
36822943 |
T |
|
| Q |
112 |
caaagatccgaataaactaattgatttacaaaatagatag------aatgcttcgaccataacagggtaacacgttacccgcaagcccttttcctccaac |
205 |
Q |
| |
|
||||||||||||||||| ||||||||||||| ||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36822942 |
caaagatccgaataaacaaattgatttacaagatagaatgctaccccatgcttcgaccataacagggtaacacgttacccgcaagcccttttcctccaac |
36822843 |
T |
|
| Q |
206 |
ccaacc |
211 |
Q |
| |
|
|||||| |
|
|
| T |
36822842 |
ccaacc |
36822837 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University