View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17964_low_24 (Length: 313)

Name: NF17964_low_24
Description: NF17964
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17964_low_24
NF17964_low_24
[»] chr5 (1 HSPs)
chr5 (12-211)||(36822837-36823041)


Alignment Details
Target: chr5 (Bit Score: 155; Significance: 3e-82; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 155; E-Value: 3e-82
Query Start/End: Original strand, 12 - 211
Target Start/End: Complemental strand, 36823041 - 36822837
Alignment:
12 atgaaactatttaaacccagacttttttgcttagattaaataaagagcaagtgaatccaacaaacttaaaatctggaaggaacaagtgattccaaccctt 111  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36823041 atgaaactatttaaacccagactttttt-cttagattaaataaagagcaagtgaatccaacaaacttaaaatctggaaggaacaagtgattccaaccctt 36822943  T
112 caaagatccgaataaactaattgatttacaaaatagatag------aatgcttcgaccataacagggtaacacgttacccgcaagcccttttcctccaac 205  Q
    ||||||||||||||||| ||||||||||||| |||||  |       |||||||||||||||||||||||||||||||||||||||||||||||||||||    
36822942 caaagatccgaataaacaaattgatttacaagatagaatgctaccccatgcttcgaccataacagggtaacacgttacccgcaagcccttttcctccaac 36822843  T
206 ccaacc 211  Q
    ||||||    
36822842 ccaacc 36822837  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University