View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17964_low_30 (Length: 290)
Name: NF17964_low_30
Description: NF17964
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17964_low_30 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 270; Significance: 1e-151; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 270; E-Value: 1e-151
Query Start/End: Original strand, 1 - 274
Target Start/End: Original strand, 8404607 - 8404880
Alignment:
| Q |
1 |
ggccatacattgacatgaagacactctatagtattggaaaggaactagggaggggtcaatttggtgtcacttatctttgtaccgaaaatgccaccggaag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
8404607 |
ggccatacattgacatgaagacactctatagtattggaaaggaactagggaggggtcaatttggtgtcacttatctttgtaccgaaaatgccactggaag |
8404706 |
T |
 |
| Q |
101 |
aaactatgcttgtaagtccatttcgagacgaaagctaacaagaaagaaagaaattgaggatgttaaaagggaaatcatgatccttcaggacttaagtgga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8404707 |
aaactatgcttgtaagtccatttcgagacgaaagctaacaagaaagaaagaaattgaggatgttaaaagggaaatcatgatccttcaggacttaagtgga |
8404806 |
T |
 |
| Q |
201 |
caaccaaacatagttgagttcaagggtgcttatgaggatagagagagtgtgcatttggtgatggagttgtgttt |
274 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8404807 |
caaccaaacatagttgagttcaagggtgcttatgaggatagagagagtgtgcatttggtgatggagttgtgttt |
8404880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.0000001; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 195 - 240
Target Start/End: Original strand, 40531981 - 40532026
Alignment:
| Q |
195 |
agtggacaaccaaacatagttgagttcaagggtgcttatgaggata |
240 |
Q |
| |
|
|||||||||||||| || |||||||| || |||||||||||||||| |
|
|
| T |
40531981 |
agtggacaaccaaatattgttgagtttaaaggtgcttatgaggata |
40532026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 195 - 239
Target Start/End: Original strand, 40536946 - 40536990
Alignment:
| Q |
195 |
agtggacaaccaaacatagttgagttcaagggtgcttatgaggat |
239 |
Q |
| |
|
|||||||||||||| || |||||||| || ||||||||||||||| |
|
|
| T |
40536946 |
agtggacaaccaaatattgttgagtttaaaggtgcttatgaggat |
40536990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University