View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17964_low_36 (Length: 262)
Name: NF17964_low_36
Description: NF17964
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17964_low_36 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 1 - 244
Target Start/End: Complemental strand, 33330414 - 33330172
Alignment:
| Q |
1 |
tggaacatatatgcataaaatgtgtgtgaaaagtttgataagatggaaggagccatagcaagtaggacaccatgttttcctggcccacacattttcccat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33330414 |
tggaacatatatgcataaaatgtgtgtgaaaagtttgataagatggaaggagccatacgaagtaggacaccatgttttcctggcccacacattttcccat |
33330315 |
T |
|
| Q |
101 |
cttgacgtatataacggaccatgaaaaacaatgcacggccaaatcaaaatcaatcagttctctctgcttctctcatcaaatcaatcctttctcacctttc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
33330314 |
cttgacgtatataacggaccatgaaaaacaatgcatggccaaatcaaaatcaatcag-tctctctacttctctcatcaaatcaatcctttctcacctttc |
33330216 |
T |
|
| Q |
201 |
tccatacagacatacgaaggagttcaggggaatggtgtctgatt |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33330215 |
tccatacagacatacgaaggagttcaggggaatggtgtctgatt |
33330172 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University