View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17964_low_42 (Length: 241)
Name: NF17964_low_42
Description: NF17964
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17964_low_42 |
 | |
|
| [»] scaffold0012 (1 HSPs) |
| | |
|
Alignment Details
Target: chr1 (Bit Score: 212; Significance: 1e-116; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 14 - 225
Target Start/End: Original strand, 39777062 - 39777273
Alignment:
| Q |
14 |
tgaatgatgatgtaatggaagcaacagaagaatttgatgaactctgtgacttctcatgctccgtgttgctaatattaaccttaaggcagaaaacatgaac |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39777062 |
tgaatgatgatgtaatggaagcaacagaagaatttgatgaactctgtgacttctcatgctccgtgttgctaatattaaccttaaggcagaaaacatgaac |
39777161 |
T |
|
| Q |
114 |
ggtgcccttatcactagagactgctaaccactgagccgtagatgagaacgccaaactgtaaatctctgccgcatttgcaccccttcttacctaaatttga |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39777162 |
ggtgcccttatcactagagactgctaaccactgagccgtagatgagaacgccaaactgtaaatctctgccgcatttgcaccccttcttacctaaatttga |
39777261 |
T |
|
| Q |
214 |
tcccaagaaact |
225 |
Q |
| |
|
|||||||||||| |
|
|
| T |
39777262 |
tcccaagaaact |
39777273 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 90 - 150
Target Start/End: Complemental strand, 20607740 - 20607680
Alignment:
| Q |
90 |
aaccttaaggcagaaaacatgaacggtgcccttatcactagagactgctaaccactgagcc |
150 |
Q |
| |
|
||||||||||| |||||||| || || ||||||||||| || |||||||||||||||||| |
|
|
| T |
20607740 |
aaccttaaggctaaaaacatggacagtacccttatcacttgaaactgctaaccactgagcc |
20607680 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 62; Significance: 7e-27; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 87 - 208
Target Start/End: Complemental strand, 44207449 - 44207328
Alignment:
| Q |
87 |
attaaccttaaggcagaaaacatgaacggtgcccttatcactagagactgctaaccactgagccgtagatgagaacgccaaactgtaaatctctgccgca |
186 |
Q |
| |
|
|||||||||||||| || |||||||| |||||||| ||||| || ||||||||||||||||| || || || ||||||||||| || |||||||| ||| |
|
|
| T |
44207449 |
attaaccttaaggctaaagacatgaacagtgcccttgtcacttgaaactgctaaccactgagctgtggaggaaaacgccaaactatatatctctgctgca |
44207350 |
T |
|
| Q |
187 |
tttgcaccccttcttacctaaa |
208 |
Q |
| |
|
|||||||||||||| ||||||| |
|
|
| T |
44207349 |
tttgcaccccttctaacctaaa |
44207328 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0012 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: scaffold0012
Description:
Target: scaffold0012; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 124 - 208
Target Start/End: Complemental strand, 185272 - 185187
Alignment:
| Q |
124 |
tcactagagactgctaaccactgagccgtagatgagaacgccaaactgtaaatctctgccg-catttgcaccccttcttacctaaa |
208 |
Q |
| |
|
||||| || ||||||||||||| |||||| || || ||||||||||| | || ||||| | |||||||||||||||||||||||| |
|
|
| T |
185272 |
tcacttgaaactgctaaccactaagccgtggaagaaaacgccaaactacatatttctgctggcatttgcaccccttcttacctaaa |
185187 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University