View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17964_low_43 (Length: 239)
Name: NF17964_low_43
Description: NF17964
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17964_low_43 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 1 - 198
Target Start/End: Original strand, 7631361 - 7631558
Alignment:
| Q |
1 |
tattctattactttgcttttgagttctatgataaaaaccgttaaaccagagttcttatataatgtatgaaatttgatccatctctgaatgtacatccaat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
7631361 |
tattctattactttgcttttgagttctatgataaaaaccgttaaatcatagttcttatataatgtatgaaatttgatccatctctgaatgtacacccaat |
7631460 |
T |
 |
| Q |
101 |
ggattatttgatccatattgatgcaatgcggccagatgaagactggcgcctactaaaacaaaggggagtaccctctattgttttcgttaccaagatat |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| | |||||| |
|
|
| T |
7631461 |
ggattatttgatccatattgatgcaatgcggccagatgaagattggcgcctactaaaacaaaggggagtaccctctattgttttcgttatcgagatat |
7631558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University