View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17965_high_3 (Length: 350)
Name: NF17965_high_3
Description: NF17965
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17965_high_3 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 317; Significance: 1e-179; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 317; E-Value: 1e-179
Query Start/End: Original strand, 18 - 338
Target Start/End: Original strand, 10450175 - 10450495
Alignment:
| Q |
18 |
tttacttcctctgtattcaaattcaaatgccactccttgcgcggtcttttcaccacttcctttctttttcttatgcaaaactttcattgctgtacaaccg |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10450175 |
tttacttcctctgtattcaaattcaaatgccactcctcgcgcggtcttttcaccacttcctttctttttcttatgcaaaactttcattgctgtacaaccg |
10450274 |
T |
|
| Q |
118 |
ggaagaatcgccccattgccagatttcaccaagtccaccaaccatgtttccgatgtacccttcttctttccatccttacatcccaaacagcaccatccac |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10450275 |
ggaagaatcgccccattgccagatttcaccaagtccaccaaccatgtttccgatgtacccttcttctttccatccttacatcccaaacagcaccatccac |
10450374 |
T |
|
| Q |
218 |
agtagtgatcaggcgaagcattcctcggaatgttattcacaggatatcccatttcttgacacccttttcgcaaaattgcgttgttgaaaccttcctcttc |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10450375 |
agtagtgatcaggcgaagcattcctcggaatgttattcacaggatatcccatttcttgacacccttttcgcaaaattgcgttgttgaaaccttcctcttc |
10450474 |
T |
|
| Q |
318 |
tatctcggactgaactcccat |
338 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
10450475 |
tatctcggactgaactcccat |
10450495 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 85; Significance: 2e-40; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 118 - 286
Target Start/End: Complemental strand, 30495149 - 30494981
Alignment:
| Q |
118 |
ggaagaatcgccccattgccagatttcaccaagtccaccaaccatgtttccgatgtacccttcttctttccatccttacatcccaaacagcaccatccac |
217 |
Q |
| |
|
|||||||| || || || || ||||||||||||||||| | ||||||||| |||||||| ||||||||||||||||| |||||||| || ||||| |||| |
|
|
| T |
30495149 |
ggaagaattgcaccgttacccgatttcaccaagtccacaagccatgtttctgatgtacctttcttctttccatccttgcatcccaagcaacaccaaccac |
30495050 |
T |
|
| Q |
218 |
agtagtgatcaggcgaagcattcctcggaatgttattcacaggatatcccatttcttgacacccttttc |
286 |
Q |
| |
|
|||| ||||| || | ||||||||| ||||||||| | |||||||| |||||||||||||||||||||| |
|
|
| T |
30495049 |
agtaatgatctggtggagcattcctaggaatgttactaacaggataccccatttcttgacacccttttc |
30494981 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University