View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17966_high_3 (Length: 386)
Name: NF17966_high_3
Description: NF17966
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17966_high_3 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 361; Significance: 0; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 361; E-Value: 0
Query Start/End: Original strand, 1 - 361
Target Start/End: Complemental strand, 38816530 - 38816170
Alignment:
| Q |
1 |
tctaaggctttcttgttgtgtgttcaggtgaagatttgagtgatcttgctgtggaacattcaatttgcccttctaaagatgaaggaggaatgcttgggtg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38816530 |
tctaaggctttcttgttgtgtgttcaggtgaagatttgagtgatcttgctgtggaacattcaatttgcccttctaaagatgaaggaggaatgcttgggtg |
38816431 |
T |
|
| Q |
101 |
ggtgagaaagggacaaatggtatgctgttgtttaggtttaattaaaccttgttcttagggttttacattttgtctagattttgcagttggctactttttg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38816430 |
ggtgagaaagggacaaatggtatgctgttgtttaggtttaattaaaccttgttcttagggttttacattttgtctagattttgcagttggctactttttg |
38816331 |
T |
|
| Q |
201 |
tggttacagttggtatacatcacggccttatgtaaattaaactgactttgtctgttagagaagggtatatagttgtatgaggtttctttgggtaggtgag |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38816330 |
tggttacagttggtatacatcacggccttatgtaaattaaactgactttgtctgttagagaagggtatatagttgtatgaggtttctttgggtaggtgag |
38816231 |
T |
|
| Q |
301 |
aaattgaggttcaaaggatacaatataccttttcttgcattttctttcactgagttatgat |
361 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38816230 |
aaattgaggttcaaaggatacaatataccttttcttgcattttctttcactgagttatgat |
38816170 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 76; E-Value: 5e-35
Query Start/End: Original strand, 14 - 163
Target Start/End: Complemental strand, 38821928 - 38821782
Alignment:
| Q |
14 |
tgttgtgtgttcaggtgaagatttgagtgatcttgctgtggaacattcaatttgcccttctaaagatgaaggaggaatgcttgggtgggtgagaaaggga |
113 |
Q |
| |
|
|||||||||| |||||||||||||||| |||||||||||||| |||| | ||||| |||||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
38821928 |
tgttgtgtgtccaggtgaagatttgagcgatcttgctgtggactattcggtgtgcccatctaaagaagaaggaggaaggcttgggtgggtgagaaaggga |
38821829 |
T |
|
| Q |
114 |
caaatggtatgctgttgtttaggtttaattaaaccttgttcttagggttt |
163 |
Q |
| |
|
||||||||| || ||||||| ||| ||||| |||||||||||||||| |
|
|
| T |
38821828 |
caaatggta---tgatgtttagatttgcttaaatcttgttcttagggttt |
38821782 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University