View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17967_low_7 (Length: 221)
Name: NF17967_low_7
Description: NF17967
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17967_low_7 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 42882897 - 42882676
Alignment:
| Q |
1 |
atgtgagaaataacaccattgcagtcaaccatatatgtaccatcataatcattgaatataatttgatttcttnnnnnnn-cgaaagagccacaccaacac |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
42882897 |
atgtgagaaataacaccattgcagtcaaccatatatgtaccatcataatcattgaatataatttgatttcttaaaaaaaacgaaagagccacaccaacac |
42882798 |
T |
|
| Q |
100 |
tccaaattaaatgtctaaccctactttgcccacttccctctagtcagtcatccttataaattggatgaaatgagcaccaacctcattagagaacacacca |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
42882797 |
tccaaattaaatgtctaaccctactttgcccacttccctctagtcagtcatccttataaattggatgaaatgagcaacaacctcattagagaacacacca |
42882698 |
T |
|
| Q |
200 |
tcaaacccaacctaagcaccaa |
221 |
Q |
| |
|
||||||||||||| |||||||| |
|
|
| T |
42882697 |
tcaaacccaacctcagcaccaa |
42882676 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University