View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17968_low_4 (Length: 224)
Name: NF17968_low_4
Description: NF17968
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17968_low_4 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 15 - 212
Target Start/End: Complemental strand, 36703173 - 36702976
Alignment:
| Q |
15 |
ttatactccaagttttccttcaacactcatgttgaattaaggcagttgaggaaacacaatgcttattgatgaggaggtggaaatttgatctctactcttt |
114 |
Q |
| |
|
||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
36703173 |
ttataatccaagtcttccttcaacactcatgttgaattaaggcagttgaggaaacacaatggttattcatgaggaggtggaaatttgatctctactcttt |
36703074 |
T |
 |
| Q |
115 |
cttgtgtttgattcgaagggttaatttgcatgtgttgcggttcatcatagttagcacaagctttctttcctcataaccctcacattgatgaaatttct |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
36703073 |
cttgtgtttgattcgaagggttaatttgcatgtgttgcggttcatcatagttagcacaagctttctttcctcacaaccctcacatcgatgaaatttct |
36702976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University