View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17969_high_10 (Length: 211)
Name: NF17969_high_10
Description: NF17969
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17969_high_10 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 14 - 196
Target Start/End: Original strand, 1006495 - 1006676
Alignment:
| Q |
14 |
caaaggtggggtttaggagggtcacgaaagctgttagggtttaattattattctttagctagacttattaacgtggttgtcccgaattatgcaggaaatg |
113 |
Q |
| |
|
|||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1006495 |
caaaggtggggtttag-agggtcgcgaaagctgttagggtttaattattattctttagctagacttattaacgtggttgtcccgaattatgcaggaaatg |
1006593 |
T |
|
| Q |
114 |
gagccatgcactttgagagttacttgcaaaggatggtaagaatggcagcaacggaccaagccgtcttagagtattataatact |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1006594 |
gagccatgcactttgagagttacttgcaaaggatggtaagaatggcagcaacggaccaagccgtcttagagtattataatact |
1006676 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University