View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17969_high_9 (Length: 236)
Name: NF17969_high_9
Description: NF17969
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17969_high_9 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 116; Significance: 4e-59; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 86 - 221
Target Start/End: Original strand, 7259107 - 7259241
Alignment:
| Q |
86 |
ctaagtatatcacaaccaaaatcttcaataaaatacctctagagctaactagtctttagcatttcatcaaatgatatttcattcaattatgaatcataac |
185 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
7259107 |
ctaagtatatcacaaccaaaatcttcaataaaatac-tctagagctaactagtctttagcatttcaataaatgatatttcattcaattatgaatcataac |
7259205 |
T |
 |
| Q |
186 |
ttttgtttcttgatacttgtcttcgaagtataaaat |
221 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| |
|
|
| T |
7259206 |
ttttgtttcttgatacttgtcttcaaagtataaaat |
7259241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 1 - 92
Target Start/End: Original strand, 7258705 - 7258796
Alignment:
| Q |
1 |
ctatcgtagaagaaaaaacattacatctactaataaagacaacaaaaagagctcaaataaaatttgaagccaaactagaaaaagactaagta |
92 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
7258705 |
ctatcgtagaagaaaaaacattacatctactaataaagacaacaaaaagagctcaaataaaatttgaagccaaactagaaaaagaccaagta |
7258796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University