View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1796_high_12 (Length: 249)
Name: NF1796_high_12
Description: NF1796
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1796_high_12 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 152; Significance: 1e-80; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 1 - 160
Target Start/End: Complemental strand, 22461908 - 22461749
Alignment:
| Q |
1 |
cttccggatatcttcaaaaaacttccatttaattttccttttgcataagctcttgagtaagtttcagcttacgtaaagtctttgaagaagtgtatgaaaa |
100 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22461908 |
cttccggatatcttaaaaaaacttccatttaatttttcttttgcataagctcttgagtaagtttcagcttacgtaaagtctttgaagaagtgtatgaaaa |
22461809 |
T |
|
| Q |
101 |
aagaaattgaaattgaaggaagaaattgtttctttgacaaataaagctctcacctaaatt |
160 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22461808 |
aagaaattgaaattgaaggaagaaattgtttctttgacaaataaagctctcacctaaatt |
22461749 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 215 - 243
Target Start/End: Complemental strand, 22461743 - 22461715
Alignment:
| Q |
215 |
tcatgcccttgtccatgaagaataattta |
243 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
22461743 |
tcatgcccttgtccatgaagaataattta |
22461715 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University