View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1796_high_14 (Length: 243)
Name: NF1796_high_14
Description: NF1796
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1796_high_14 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 1 - 207
Target Start/End: Complemental strand, 30652469 - 30652265
Alignment:
| Q |
1 |
cttccttgattttcttctgctttcttctctccgtctctgtcacagccacaggtactcttccagctactctccacnnnnnnnnatgcacatatatatattc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||| |||||||||||||| || |
|
|
| T |
30652469 |
cttccttgattttcttctgctttcttctctccgtctctgtcacagccacaggtactcttctagctactcttcacttttttttatgcacatatatat--tc |
30652372 |
T |
|
| Q |
101 |
tttgaaacactgaacatgacactgacacgtaaacacgagtaataacagtttgaaaaacataagtgatttaataagattgtttttgaattaggcatcgttt |
200 |
Q |
| |
|
||||||||| |||| ||||||||||||||||||||| | | ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
30652371 |
tttgaaacagtgaaaatgacactgacacgtaaacactactgataacagtttgaaaaacataagtgatttaataagattgtttttgaatcaggcatcgttt |
30652272 |
T |
|
| Q |
201 |
catctta |
207 |
Q |
| |
|
||||||| |
|
|
| T |
30652271 |
catctta |
30652265 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University