View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1796_low_14 (Length: 275)
Name: NF1796_low_14
Description: NF1796
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1796_low_14 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 128; Significance: 3e-66; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 5 - 195
Target Start/End: Complemental strand, 7707601 - 7707410
Alignment:
| Q |
5 |
gacagagagaactttgctctttgttagctgccacacacctaacctgacgtacgatgcgcgttttgtgctaaaaaagtacgttttgctgtattttt-ctac |
103 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||| |||||||||||| ||||||| ||||||||||| ||||| ||||||||||| ||||||| |||| |
|
|
| T |
7707601 |
gacagagagaattttgctctttgttagctgccacacgcctaacctgacgcacgatgcacgttttgtgctgaaaaaatacgttttgctttattttttctac |
7707502 |
T |
 |
| Q |
104 |
gagtttggggaaaaggcccaattttctagcccaaacccactagcaaatatatctctaaatacaacttcttccactcacaaatattcattcaa |
195 |
Q |
| |
|
|||||||||||| | || |||||||||||||||| ||| |||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7707501 |
gagtttggggaacacacctaattttctagcccaaatccagtagcaaatatatctataaatacaacttcttccactcacaaatattcattcaa |
7707410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 197 - 271
Target Start/End: Complemental strand, 7706087 - 7706013
Alignment:
| Q |
197 |
ttcttttttgataattctataccatgtttgatcatctgatatagaatatagatttaaacattatatatttttgga |
271 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7706087 |
ttcttttttgataattctataccatgtttgatcatctgatatagaatatagatttaaacattatatatttttgga |
7706013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 159 - 194
Target Start/End: Original strand, 52998722 - 52998757
Alignment:
| Q |
159 |
taaatacaacttcttccactcacaaatattcattca |
194 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||| |
|
|
| T |
52998722 |
taaatacaacttcttccactcataaatattcattca |
52998757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University