View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1796_low_15 (Length: 275)
Name: NF1796_low_15
Description: NF1796
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1796_low_15 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 261; Significance: 1e-145; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 261; E-Value: 1e-145
Query Start/End: Original strand, 1 - 269
Target Start/End: Complemental strand, 25741554 - 25741286
Alignment:
| Q |
1 |
aacaatgattctggtaagctaaattttcctttgaattctggttcagttttttcaggtcttgctttaggaaaaaatttcacttgtggtattagaaaaaaga |
100 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25741554 |
aacaatgattctggtaagctaaatgttcctttgaattctggttcagttttttcaggtcttgctttaggaaaaaatttcacttgtggtattagaaaaaaga |
25741455 |
T |
|
| Q |
101 |
atggatttgttctatgttggggtggtttatttgatagtggtggtgtgaataatcatgtgatgatgaaaagtgtttcttttgagtcaattgttgctggttt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25741454 |
atggatttgttctatgttggggtggtttatttgatagtggtggtgtgaataatcatgtgatgatgaaaagtgtttcttttgagtcaattgttgctggttt |
25741355 |
T |
|
| Q |
201 |
ggattttgtttgtggtttgagtattaaaaatttgtctcttatttgttggggtaatactaatgatgatgt |
269 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
25741354 |
ggattttgtttgtggtttgagtattaaaaatttgtctcttatttgttggggtaatactaatgaggatgt |
25741286 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University