View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1796_low_7 (Length: 410)
Name: NF1796_low_7
Description: NF1796
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1796_low_7 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 129; Significance: 1e-66; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 129; E-Value: 1e-66
Query Start/End: Original strand, 54 - 186
Target Start/End: Original strand, 43511554 - 43511686
Alignment:
| Q |
54 |
tggatgagaaaacaaaatatcaaatctttgatatatattaaacaggcagacaagtatatgggtatgtagcaaagattgtagcatgcgagaggtagaagga |
153 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
43511554 |
tggatgagaaaacaaaatatcaaatctttgatatatattaaacaggcagacaagtatatgggtatgtagctaagattgtagcatgcgagaggtagaagga |
43511653 |
T |
 |
| Q |
154 |
ttgatgctccgcatttccctaaaaagattgaaa |
186 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
43511654 |
ttgatgctccgcatttccctaaaaagattgaaa |
43511686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 321 - 394
Target Start/End: Original strand, 43512599 - 43512668
Alignment:
| Q |
321 |
tagaggtgcaattatttggataatctattgctgatcgatcattttatgatactttgcagcattctactgctatt |
394 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
43512599 |
tagaggtgcaattatttggataatctattgctgatc----attttatgatactttgcagcattctactgctatt |
43512668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 235 - 316
Target Start/End: Original strand, 43512252 - 43512331
Alignment:
| Q |
235 |
tcgagatacaggaaaactccattcaattcttgatggaaacggagnnnnnnngtaaattctccccgaaattggaagatcattt |
316 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||| |
|
|
| T |
43512252 |
tcgagatacacgaaaactccattcaattcttgatggaaacagag--tttttgtaaattctccccgaaattggaagatcattt |
43512331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 233 - 278
Target Start/End: Complemental strand, 41219257 - 41219212
Alignment:
| Q |
233 |
tgtcgagatacaggaaaactccattcaattcttgatggaaacggag |
278 |
Q |
| |
|
|||||| |||| ||||||||||||| |||||| ||||||||||||| |
|
|
| T |
41219257 |
tgtcgaaatacgggaaaactccatttaattctcgatggaaacggag |
41219212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University