View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17971_high_31 (Length: 290)
Name: NF17971_high_31
Description: NF17971
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17971_high_31 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 255; Significance: 1e-142; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 11 - 277
Target Start/End: Complemental strand, 2931058 - 2930792
Alignment:
| Q |
11 |
cagagatctaagagtgaagaaaaggaaaaatttggtgaattagaatccgttaccaaagaagaaaacggagatgaaaaacaggggaaaacagaggaaaatg |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
2931058 |
cagagatctaagagtgaagaaaaggaaaaatttggtgaattagaatccgttaccaatgaagaaaacagagatgaaaaacaggggaaaacagaggaaaatg |
2930959 |
T |
 |
| Q |
111 |
attctcttgaccaaatttacaagtgggtctcgagaaattatgaagaaaagttgaaatcaaaaatgggttttgaatcaaattcgtttcttgatgagtcttt |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2930958 |
attctcttgaccaaatttacaagtgggtctcgagaaattatgaagaaaagttgaaatcaaaaatgggttttgaatcaaattcgtttcttgatgagtcttt |
2930859 |
T |
 |
| Q |
211 |
tgttgaatggaacgtgaaagcaccattggaggttatatatgaagatgaagaaacagaggatattatt |
277 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
2930858 |
tgttgaatggaacgtgaaagcaccattggatgttatatatgaagatgaagaaacagaggatattatt |
2930792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University