View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17971_high_37 (Length: 255)
Name: NF17971_high_37
Description: NF17971
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17971_high_37 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 241
Target Start/End: Original strand, 33612666 - 33612906
Alignment:
| Q |
1 |
ctggatgacctattcccacccctaattgcaatgcagcataagttttatagaaatctattagatgggatttgtattctactatttttcttgccgttgtaat |
100 |
Q |
| |
|
||||||||||||||| || ||||||||||| ||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33612666 |
ctggatgacctattctcatccctaattgcattgcagcacaagttttatataaatctattagatgggatttgtattctactatttttcttgccgttgtaat |
33612765 |
T |
 |
| Q |
101 |
tttgcgttttgtggtaatgcagtagttaattttgtctatcggatgcatccactagcattatatttttgtaattggtctgcatcttactttctttaatttg |
200 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33612766 |
tttgcgttttgtggtaatgcaggagttaattttgtctatcggatgcatccactagcattatatttttgtaattggtctgcatcttactttctttaatttg |
33612865 |
T |
 |
| Q |
201 |
ctgttaactttgacatttcttgtgactgttagccctttgct |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
33612866 |
ctgttaactttgacatttcttgtgactgttagccctctgct |
33612906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University