View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17971_low_44 (Length: 239)
Name: NF17971_low_44
Description: NF17971
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17971_low_44 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 14883968 - 14883746
Alignment:
| Q |
1 |
attccaccttctctctccaaacttactaaactagaatctttgcttttgttctccaaccaactgacgagtcaaattcctgttgagtttggctcgttggtga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| | ||| ||||||||||| |||| |
|
|
| T |
14883968 |
attccaccttctctctccaaacttactaaactagaatctttgcttttgttctccaaccaacttacgagtcaaattcccgctgattttggctcgttagtga |
14883869 |
T |
|
| Q |
101 |
atctccgatttttgcgactcggtgataatcaactcagtggtgaaattccctcttcattaggcaatcttgctaaacttgtcacccttgggttagcttcatg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
14883868 |
atctccgatttttgcgactcggtgataatcaactcagtggtgaaattccctcttcattaggcaatcttgttaaacttgtcacccttgggttagcttcatg |
14883769 |
T |
|
| Q |
201 |
caaactcaacggttcgatcccga |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
14883768 |
caaactcaacggttcgatcccga |
14883746 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University