View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17971_low_45 (Length: 238)
Name: NF17971_low_45
Description: NF17971
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17971_low_45 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 19 - 221
Target Start/End: Complemental strand, 30784170 - 30783968
Alignment:
| Q |
19 |
tgtactttatcgggttttattaaatgaattgttagtttaaattagtttaacattaacgcataaaggattaaacaataagttgtagaggattaaactacat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30784170 |
tgtactttatcgggttttattaaatgaattgttagtttaaattagtttaacattaacgcataaaggattaaacaataagttgtagaggattaaactacat |
30784071 |
T |
 |
| Q |
119 |
attatcgggttttatgtcaaaattgattctaactacatatagtctcttttcaaagtgtgtgctactcggtaaaggattaaacaataagtttaactggtac |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||| |
|
|
| T |
30784070 |
attatcgggttttatgtcaaaattgattctaactacatatagtctcttttcaaagtgtgtgctactcagacaaggattaaacaataagtttaactggtac |
30783971 |
T |
 |
| Q |
219 |
tat |
221 |
Q |
| |
|
||| |
|
|
| T |
30783970 |
tat |
30783968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University