View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17972_high_39 (Length: 285)
Name: NF17972_high_39
Description: NF17972
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17972_high_39 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 167; Significance: 2e-89; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 81 - 268
Target Start/End: Complemental strand, 8509984 - 8509797
Alignment:
| Q |
81 |
tcatgatatgcaaagggattttgcagggtggaatagggtgtggggtatatttcatagttattttacaaatttgatagttgctagtgttcttctatagttc |
180 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8509984 |
tcatgatatgcaaagggattttgcagggtggaatagggtgtggggtatatttcatagttattttacaaatttgatagttgctagtgttcttctatagttc |
8509885 |
T |
|
| Q |
181 |
tacttctatccaattttaannnnnnnggtaaagtatagttctattcaattagcatgtgagtaatttgtaaagatgaatgtaagggatg |
268 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8509884 |
tacttctatccaattttaatttttttggtaaagtatagttctattcaattagcatgtgagtaatttgtaaagatgaatgtaagggatg |
8509797 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University