View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17972_high_52 (Length: 245)
Name: NF17972_high_52
Description: NF17972
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17972_high_52 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 46 - 237
Target Start/End: Complemental strand, 3284539 - 3284349
Alignment:
| Q |
46 |
atgtactattattgtattgtatgatgagttagtaccatgcaacaattgtgatgtctacattgtgccatttctttggaggaacataaaaggcccacccact |
145 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3284539 |
atgtactattat-gtattgtatgatgagttagtaccatgcaacaattgtgatgtctacattgtgccatttctttggaggaacataaaaggcccacccact |
3284441 |
T |
 |
| Q |
146 |
tattcagcttagaggacactatttgattgagacattgtctcttgaattgtttctctcaactttaacaaatgtagtaatgattcctctagtat |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3284440 |
tattcagcttagaggacactatttgattgagacattgtctcttgaattgtttctctcaactttaacaaatgtagtaatgattcctctagtat |
3284349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University