View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17972_high_60 (Length: 222)

Name: NF17972_high_60
Description: NF17972
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17972_high_60
NF17972_high_60
[»] chr8 (2 HSPs)
chr8 (103-181)||(574585-574660)
chr8 (60-88)||(574496-574524)


Alignment Details
Target: chr8 (Bit Score: 40; Significance: 0.00000000000008; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 103 - 181
Target Start/End: Original strand, 574585 - 574660
Alignment:
103 ataactagggtaaggctagcacattattcnnnnnnnagggatgctagcacattattattctagtaaccagaacaagtat 181  Q
    |||||||||||||||||||||||||||||        |||||||||||||   ||||||||||||||||||||||||||    
574585 ataactagggtaaggctagcacattattcttttttttgggatgctagcac---attattctagtaaccagaacaagtat 574660  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 60 - 88
Target Start/End: Original strand, 574496 - 574524
Alignment:
60 ttcactcatacttatattccgttcgtaaa 88  Q
    |||||||||||||||||||||||||||||    
574496 ttcactcatacttatattccgttcgtaaa 574524  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University