View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17972_high_62 (Length: 210)

Name: NF17972_high_62
Description: NF17972
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17972_high_62
NF17972_high_62
[»] chr4 (1 HSPs)
chr4 (160-210)||(53562534-53562584)


Alignment Details
Target: chr4 (Bit Score: 47; Significance: 5e-18; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 160 - 210
Target Start/End: Complemental strand, 53562584 - 53562534
Alignment:
160 tgatgcatacagcagaacacgcagagcagcaacacagaaagcataagagct 210  Q
    |||||||||||||| ||||||||||||||||||||||||||||||||||||    
53562584 tgatgcatacagcaaaacacgcagagcagcaacacagaaagcataagagct 53562534  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University