View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17972_low_19 (Length: 424)
Name: NF17972_low_19
Description: NF17972
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17972_low_19 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 334; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 334; E-Value: 0
Query Start/End: Original strand, 16 - 409
Target Start/End: Complemental strand, 7092516 - 7092119
Alignment:
| Q |
16 |
catagtatattgtatttgaatgtaatatgtgtcaatctagtatccccttttcgagatagatttttctatgttgctattggcatgacttgagccctctcat |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7092516 |
catagtatattgtatttgaatgtaatatgtgtcaatctattatccccttttcgagatagatttttctatgttgctattggcatgacttgagccctctcat |
7092417 |
T |
|
| Q |
116 |
ataggaactaaaatgattcggtttggtttggttatcctcaaaggtatctctctatctttgtgatgttttgtttttaattgtaggggaacttttaggaatg |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7092416 |
ataggaactaaaatgattcggtttggtttggttatcctcaaaggtatctctctatctttgtgatgttttgtttttaattgtaggggaacttttaggaatg |
7092317 |
T |
|
| Q |
216 |
attcttgtaggatccgtccttcacaaaaaccattgtccctagctaggtgtattaccattaatttacaatataatatgaataatttatccct-nnnnnnnt |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
7092316 |
attcttgtaggatccgtccttcacaaaaaccattgtccctagctaggtgtattaccattaatttacaatataatatgaataatttatccctaaaaaaaat |
7092217 |
T |
|
| Q |
315 |
taataatttaattctagtttcataataatacacct--taaag-tataattagtgcctttgacatccatgatttctctaattggtaaatgcaataaaaa |
409 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||| | | |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7092216 |
taataatttaattctagtttcataataatacaccttataaagattttgttagtgcctttgacatccatgatttctctaattggtaaatgcaataaaaa |
7092119 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University