View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17972_low_35 (Length: 336)
Name: NF17972_low_35
Description: NF17972
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17972_low_35 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 118; Significance: 4e-60; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 118; E-Value: 4e-60
Query Start/End: Original strand, 12 - 158
Target Start/End: Original strand, 30355395 - 30355541
Alignment:
| Q |
12 |
attattcttactcacatgctttcaattacccttgaaaaacaaaatccctatatctataatttatgttatacatttcctcnnnnnnntaaataatttatgt |
111 |
Q |
| |
|
|||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
30355395 |
attactcttactcacatgctttcaattagccttgaaaaacaaaatccctatatctataatttatgttatacatttcctcaaaaaaataaataatttatgt |
30355494 |
T |
|
| Q |
112 |
tatacataacgaaaatacatggtggagtactggagtagttttttact |
158 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30355495 |
tatacataacgaaaatacatggtggagtactggagtagttttttact |
30355541 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 269 - 318
Target Start/End: Original strand, 30356184 - 30356233
Alignment:
| Q |
269 |
gagacaacacgtgtcaaacagccaatgtaagcaatgacacctgcaccaat |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30356184 |
gagacaacacgtgtcaaacagccaatgtaagcaatgacacctgcaccaat |
30356233 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 183 - 223
Target Start/End: Original strand, 30356099 - 30356139
Alignment:
| Q |
183 |
taatgcgattcatgtcgagactaggcacactgtttctactt |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30356099 |
taatgcgattcatgtcgagactaggcacactgtttctactt |
30356139 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University