View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17972_low_42 (Length: 290)
Name: NF17972_low_42
Description: NF17972
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17972_low_42 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 252; Significance: 1e-140; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 1 - 272
Target Start/End: Original strand, 40902668 - 40902939
Alignment:
| Q |
1 |
aaactgtctgcatccgatggtgtgcagaactggaaatggagttggagtccaaatctgaaccatgaagaaaatcagcctgctgttgaactggtcattgccc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40902668 |
aaactgtctgcatccgatggtgtgcagaactggaaatggagttggagtcgaaatctgaaccatgaagaaaatcagcctgctgttgaactggtcattgccc |
40902767 |
T |
 |
| Q |
101 |
tgcctacagtgcagctgcaggaaggcgtgacacatacgtttaaatacggaagattacattggcttctcggttacgtttaagtacggaagattacatcggt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
40902768 |
tgcctacagtgcagctgcaggaaggcgtgacacatacgtttaaatacggaagattacattggtttctcagttacgtttaagtacggaagattacatcggt |
40902867 |
T |
 |
| Q |
201 |
ttctcagttaaataccgtttatattctgctctgtggtttgcataattctgcagaatagggcgatgattttat |
272 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
40902868 |
ttctcagttaaataccgtttatattctgctctgtggtttgcataattcggcagaatacggcgatgattttat |
40902939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 14 - 80
Target Start/End: Original strand, 30149610 - 30149676
Alignment:
| Q |
14 |
ccgatggtgtgcagaactggaaatggagttggagtccaaatctgaaccatgaagaaaatcagcctgc |
80 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| |||||||||||||||| |||||| |||||| |
|
|
| T |
30149610 |
ccgatggtgtgcagaactggaaatgaagttggagtcgaaatctgaaccatgaacaaaatctgcctgc |
30149676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University