View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17972_low_44 (Length: 282)
Name: NF17972_low_44
Description: NF17972
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17972_low_44 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 18 - 265
Target Start/End: Original strand, 7387074 - 7387323
Alignment:
| Q |
18 |
aagaaacacaaaacaacggaacacatgtttgatgtgaagttcatctaag--tgtgtaggcttgtgacaaaatagtatttgtagtttcgtaattgatatct |
115 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |||||||| ||||| ||||||| ||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
7387074 |
aagaaacacaaaacagtggaacacatgtttgatgcgaagttcaactaagagtgtgtagacttgtgacaaaatagtatttgtagtttcgtaattgatgtct |
7387173 |
T |
|
| Q |
116 |
tatataaatactacggttcaaattacaacaatgcctcttaactatagcgtgaggacctatggcctccacatctccagtcacccctacaacaatcagttgg |
215 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
7387174 |
tatataaatactacggttcaaattacaataatgcctcttaactatagcgtgaggacctatggcctccacatctccggtcacccctacaacaatcagttgg |
7387273 |
T |
|
| Q |
216 |
acaaacacaatggtagggccaaagctcactcctctcactcgtctcttatt |
265 |
Q |
| |
|
||||||||||||||||||||||||||| ||| ||||||| |||||||||| |
|
|
| T |
7387274 |
acaaacacaatggtagggccaaagctcgctcttctcacttgtctcttatt |
7387323 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University