View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17972_low_52 (Length: 250)
Name: NF17972_low_52
Description: NF17972
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17972_low_52 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 46388539 - 46388764
Alignment:
| Q |
1 |
cttaaatcacactgaatgcggtcatgttaaggttgagaagattcatgatgtcacttaatagtagcaatcaacttatattttctac---cattttataagt |
97 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
46388539 |
cttaaatcacactgaatgcggtcatgttaaggttgagaagattcatgatatcacctaatagtagcaatcaacttatattttctactaccattttataagt |
46388638 |
T |
 |
| Q |
98 |
cttttccccacttttccttaaatttatcggtttgtgtcgagtagtgtctatttccatttttcttacnnnnnnnagctttggagaaatgaatgtttaacat |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
46388639 |
cttttccccacttttccttaaatttatcggtttgtgtcgagtagtgtctatttccatttttcttacttttttgagctttggagaaatgaatgtttaacat |
46388738 |
T |
 |
| Q |
198 |
gattataacatttggcaagaataggt |
223 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
46388739 |
gattataacatttggcaagaataggt |
46388764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University