View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17972_low_54 (Length: 246)
Name: NF17972_low_54
Description: NF17972
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17972_low_54 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 5 - 232
Target Start/End: Complemental strand, 46388466 - 46388237
Alignment:
| Q |
5 |
attaccatggtctatttaccttaaatatctctctctaacttccaatcttactgctttctctctc--cctctaggaattagaactcaaacggggtagcact |
102 |
Q |
| |
|
||||||||||||||| |||| |||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
46388466 |
attaccatggtctatctaccctaaacatctctctctaacttccaatcttactgctttctctctctccctctaggaattagaactcaaacggggtagcact |
46388367 |
T |
|
| Q |
103 |
catgtcattcaccaggcattggacatcggctcctcctcccataaactctacataaattcattctcactccacaccatgttcatggaagtgtgtcgtatgc |
202 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46388366 |
catgtcattcaccaggcactggacatcggctcctcctcccataaactctacataaattcattctcactccacaccatgttcatggaagtgtgtcgtatgc |
46388267 |
T |
|
| Q |
203 |
cacccatcgtgcagtctctgttgacctttt |
232 |
Q |
| |
|
||||||||||| |||||||||||||||||| |
|
|
| T |
46388266 |
cacccatcgtgtagtctctgttgacctttt |
46388237 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University