View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17972_low_56 (Length: 245)

Name: NF17972_low_56
Description: NF17972
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17972_low_56
NF17972_low_56
[»] chr2 (1 HSPs)
chr2 (46-237)||(3284349-3284539)


Alignment Details
Target: chr2 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 46 - 237
Target Start/End: Complemental strand, 3284539 - 3284349
Alignment:
46 atgtactattattgtattgtatgatgagttagtaccatgcaacaattgtgatgtctacattgtgccatttctttggaggaacataaaaggcccacccact 145  Q
    |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3284539 atgtactattat-gtattgtatgatgagttagtaccatgcaacaattgtgatgtctacattgtgccatttctttggaggaacataaaaggcccacccact 3284441  T
146 tattcagcttagaggacactatttgattgagacattgtctcttgaattgtttctctcaactttaacaaatgtagtaatgattcctctagtat 237  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3284440 tattcagcttagaggacactatttgattgagacattgtctcttgaattgtttctctcaactttaacaaatgtagtaatgattcctctagtat 3284349  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University