View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17972_low_57 (Length: 241)
Name: NF17972_low_57
Description: NF17972
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17972_low_57 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 154; Significance: 8e-82; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 154; E-Value: 8e-82
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 7570161 - 7570391
Alignment:
| Q |
1 |
aatgatgctggtgcagagaataatttgtatccatttgttattctcaatgtggatggcaacctcttcatctttgctaacaacagagctatcctctttgatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7570161 |
aatgatgctggtgcagagaataatttgtatccatttgttattctcaatgtggatggcaacctcttcatctttgctaacaacagagctatcctctttgatt |
7570260 |
T |
 |
| Q |
101 |
atactaaggtagtcattttactgttacattgtgtttgttaaggttgcttcttttttaca-ttgaactaaac----------taagctagtatatgttttt |
189 |
Q |
| |
|
||||||||||| | |||||||| || |||| |||||||||||||||||||||||||||| ||||||||||| | ||||||||||||||||| |
|
|
| T |
7570261 |
atactaaggta-ttattttact-ttgcattatgtttgttaaggttgcttcttttttacatttgaactaaacaaagatagctttagctagtatatgttttt |
7570358 |
T |
 |
| Q |
190 |
cttttgtggttttaattatttggtgtgatcttt |
222 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| |
|
|
| T |
7570359 |
cttttgtggttttaattatttggtgtgaacttt |
7570391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 19 - 111
Target Start/End: Original strand, 530245 - 530337
Alignment:
| Q |
19 |
aataatttgtatccatttgttattctcaatgtggatggcaacctcttcatctttgctaacaacagagctatcctctttgattatactaaggta |
111 |
Q |
| |
|
||||| |||||||| |||||| |||||||||| ||||| |||||||| ||| | || ||||| | | |||| ||||| ||||||||||||||| |
|
|
| T |
530245 |
aataacttgtatccttttgtttttctcaatgtcgatggtaacctctttatcatggccaacaataaatctattctcttcgattatactaaggta |
530337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University