View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17972_low_61 (Length: 237)
Name: NF17972_low_61
Description: NF17972
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17972_low_61 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 33 - 221
Target Start/End: Complemental strand, 55300957 - 55300769
Alignment:
| Q |
33 |
atttgatgttactctctccctcaaatgctttctcttatgctcttcaaccaacaacacaacatcgtcacacaaaattgttttctctggaatagtttctgat |
132 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55300957 |
atttgatgttactctctccctcaaaggctttctcttatgctcttcaaccaacaacacaacatcgtcacacaaaattgttttctctggaatagtttctgat |
55300858 |
T |
|
| Q |
133 |
tcataattaaccctcaaaggcttcccgccttcaacatcgtcactaccgtcgtccatcttctccaaagttgcttgtgatgatgacggatt |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55300857 |
tcataattaaccctcaaaggcttcccgccttcaacatcgtcactaccgtcgtccatcttctccaaagttgcttgtgatgatgacggatt |
55300769 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University