View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17972_low_65 (Length: 222)
Name: NF17972_low_65
Description: NF17972
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17972_low_65 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 40; Significance: 0.00000000000008; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 103 - 181
Target Start/End: Original strand, 574585 - 574660
Alignment:
| Q |
103 |
ataactagggtaaggctagcacattattcnnnnnnnagggatgctagcacattattattctagtaaccagaacaagtat |
181 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
574585 |
ataactagggtaaggctagcacattattcttttttttgggatgctagcac---attattctagtaaccagaacaagtat |
574660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 60 - 88
Target Start/End: Original strand, 574496 - 574524
Alignment:
| Q |
60 |
ttcactcatacttatattccgttcgtaaa |
88 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
574496 |
ttcactcatacttatattccgttcgtaaa |
574524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University