View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17972_low_68 (Length: 210)
Name: NF17972_low_68
Description: NF17972
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17972_low_68 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 47; Significance: 5e-18; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 160 - 210
Target Start/End: Complemental strand, 53562584 - 53562534
Alignment:
| Q |
160 |
tgatgcatacagcagaacacgcagagcagcaacacagaaagcataagagct |
210 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
53562584 |
tgatgcatacagcaaaacacgcagagcagcaacacagaaagcataagagct |
53562534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University