View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17973_high_20 (Length: 274)

Name: NF17973_high_20
Description: NF17973
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17973_high_20
NF17973_high_20
[»] chr1 (3 HSPs)
chr1 (1-63)||(41524807-41524869)
chr1 (201-258)||(41525001-41525058)
chr1 (108-138)||(41524908-41524938)


Alignment Details
Target: chr1 (Bit Score: 63; Significance: 2e-27; HSPs: 3)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 1 - 63
Target Start/End: Original strand, 41524807 - 41524869
Alignment:
1 tgacaaataaatattcatacttccattcatttcatacactcgtcgcgatatctcggaatagaa 63  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41524807 tgacaaataaatattcatacttccattcatttcatacactcgtcgcgatatctcggaatagaa 41524869  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 201 - 258
Target Start/End: Original strand, 41525001 - 41525058
Alignment:
201 ccgttagggttttgcctgaattttattgttaaaccctagatttattttgtaatctgca 258  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41525001 ccgttagggttttgcctgaattttattgttaaaccctagatttattttgtaatctgca 41525058  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 108 - 138
Target Start/End: Original strand, 41524908 - 41524938
Alignment:
108 gaagtaagctattgtctaaatcttcaatgtg 138  Q
    |||||||||||||||||||||||||||||||    
41524908 gaagtaagctattgtctaaatcttcaatgtg 41524938  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University