View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17973_high_25 (Length: 217)
Name: NF17973_high_25
Description: NF17973
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17973_high_25 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 10 - 202
Target Start/End: Complemental strand, 9501125 - 9500933
Alignment:
| Q |
10 |
tccaagaatatttacagtcgtgaacaagtgcaaccacacagtctggcccgctatttcacctcggccaatcaccccaatgctctcaacaacgggttttgcc |
109 |
Q |
| |
|
||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9501125 |
tccaacaacatttacagtcgtgaacaagtgcaaccacacagtctggcccgctatttcacctcggccaatcaccccaatgctctcaacaacgggttttgcc |
9501026 |
T |
|
| Q |
110 |
cttgcacccggggagttgagtaccataagtatcgcgatcccaccttcgtggtcaggccacttgtgggcacggaccctctgcgctaatgatatc |
202 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
9501025 |
cttgcacccggggagttgagtaccataattatcgcgatcccaccttcgtggtcaggccacttgtgggcacggacactctgcgctaatgatatc |
9500933 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University