View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17973_low_21 (Length: 274)
Name: NF17973_low_21
Description: NF17973
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17973_low_21 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 63; Significance: 2e-27; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 1 - 63
Target Start/End: Original strand, 41524807 - 41524869
Alignment:
| Q |
1 |
tgacaaataaatattcatacttccattcatttcatacactcgtcgcgatatctcggaatagaa |
63 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41524807 |
tgacaaataaatattcatacttccattcatttcatacactcgtcgcgatatctcggaatagaa |
41524869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 201 - 258
Target Start/End: Original strand, 41525001 - 41525058
Alignment:
| Q |
201 |
ccgttagggttttgcctgaattttattgttaaaccctagatttattttgtaatctgca |
258 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41525001 |
ccgttagggttttgcctgaattttattgttaaaccctagatttattttgtaatctgca |
41525058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 108 - 138
Target Start/End: Original strand, 41524908 - 41524938
Alignment:
| Q |
108 |
gaagtaagctattgtctaaatcttcaatgtg |
138 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
41524908 |
gaagtaagctattgtctaaatcttcaatgtg |
41524938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University