View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17973_low_27 (Length: 213)
Name: NF17973_low_27
Description: NF17973
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17973_low_27 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 20 - 194
Target Start/End: Complemental strand, 8344260 - 8344086
Alignment:
| Q |
20 |
atatatatatgagtgttactgagcttcgatttaaacaaaaatgtgaagttatcccatgtaattcatgctcggtcactagtagctagtgttctctcaaatt |
119 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||| |
|
|
| T |
8344260 |
atatatatatgagtgttactgagcttctatttaaacaaaaatgtgaagttatcccatgtaatccatgctcggtcactagtagctagtgtgctctcaaatt |
8344161 |
T |
|
| Q |
120 |
gtgaacgaataggttgtgcatgacatttgcatggtctagagaaataaagatatgctattataatagcacatcctt |
194 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
8344160 |
gtgaatgaataggttgtgcatgacatttgcatggtctagagaaataaagatatactattataatagcacatcctt |
8344086 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University