View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17973_low_28 (Length: 206)
Name: NF17973_low_28
Description: NF17973
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17973_low_28 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 1 - 190
Target Start/End: Original strand, 56312436 - 56312625
Alignment:
| Q |
1 |
cgagataggaagtatcgaaacggtgatcgtccaaatcgtgtaacaacttctggttattggaaggcaacaggagcagataggatgattcgaactgaaaact |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
56312436 |
cgagataggaagtatcgaaacggtgatcgtccaaatcgtgtaacaacttctggttattggaaggcaacaggagcggataggatgattcgaactgaaaact |
56312535 |
T |
|
| Q |
101 |
tccgttcaattggactcaagaaaaccctagttttctattctggaaaagctcctaaaggcatccgaaccagttggattatgaatgagtata |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56312536 |
tccgttcaattggactcaagaaaaccctagttttctattctggaaaagctcctaaaggcatccgaaccagttggattatgaatgagtata |
56312625 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University