View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17974_high_2 (Length: 295)
Name: NF17974_high_2
Description: NF17974
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17974_high_2 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 121; Significance: 5e-62; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 121; E-Value: 5e-62
Query Start/End: Original strand, 23 - 183
Target Start/End: Complemental strand, 47691708 - 47691550
Alignment:
| Q |
23 |
agggcaccgtacagtatgatgtgatgtaaatttattaagcatgtggtacgaaacatattaaaaaatgcacaaagaaaatatgtatttcctcatatttgtg |
122 |
Q |
| |
|
||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||| |||||||||| | |
|
|
| T |
47691708 |
agggcaccgcacattatgatgtgatgtaaatttattaagcatgtggtacgaaacatattaaaaagtgca-aaagaaaatatgtattttctcatatttgcg |
47691610 |
T |
 |
| Q |
123 |
tttgaactcttttagaaaatatttcatgatttagtctcattaaagctcatgatcttccttc |
183 |
Q |
| |
|
||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
47691609 |
tttgaactcttttag-aaatatttcatgttttagtctcattaaagctcatgatcttccttc |
47691550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University